Es real...

El toro de la izquierda nació con una mutación concreta en ambas copias de la pareja de genes que regulan la miostatina (un factor de crecimiento). 

Como resultado, su tejido muscular crece de forma desmesurada, y disminuye la acumulación de grasa.

La “piernecita” que veis a su lado es la de un niño de 7 meses con las mismas mutaciones , al que apodaron “Mr. Universe Junior”. 

A sus 8 años el niño mantiene un tono muscular y fuerza física muy superior a la de los niños de su edad. Su madre, que tiene un gen mutado, es una sprinter profesional.

Un ejemplo parecido es el de Eero Mäntyranta, campeón olímpico de esquí de fondo en el año 1964. Tiempo después de ganar su medalla se descubrió que tenía una mutación el receptor de la hormona EPO, hecho que le proporcionaba una cantidad de glóbulos rojos en sangre mucho más elevada de lo normal.

Methods

The study was approved by the institutional ethics review committee of the Charité, University Medical Center Berlin. Written informed consent was obtained from the child's mother as well as from the parents of all control subjects. Investigations were conducted in accordance with the Declaration of Helsinki (2000).

All three exons of myostatin and flanking intron sequences (GenBank NT_022197) were amplified from genomic DNA by means of the polymerase chain reaction (PCR) with the following oligonucleotides: exon 1 forward primer, 5'ATTCACTGGTGTGGCAAGTTG3'; exon 1 reverse primer, 5'CAGCAGAACTGTTGATATACACTAATAGG3'; exon 2 forward primer,5'GTTAATGGGAAATAATTTCAGCAAC3'; exon 2 reverse primer, 5'AGGTTATTATAATGTTATTTTCAGTTATCAC3'; exon 3 forward primer, 5'CAGGCCTATTGATATTACTGATTGTTC3'; andexon 3 reverse primer, 5'GACTGTAGCATACTCTAGGCCTATAGCC3'. 

The samples were then subjected to bidirectional automatic sequencing (BigDye Terminator, Applied Biosystems), and the presence of the g.IVS1+5 g" border="0">a mutation was verified by a primer-induced restriction assay with the forward primer 5'CAAAGCTCCTCCACTCCGG3' and the reverse-mismatch primer (mismatch underlined) 5'CAGCAGAACTGTTCATATACACTAATAGGTCTA3'. Total RNA was extracted from Epstein–Barr virus (EBV)– immortalized lymphoblastoid cells with TRIzol and reverse-transcribedwith Superscript III (Invitrogen). Several primer combinations across the boundary between exon 1 and exon 2 were used: 5'CATGCAAAAACTGCAACTCTGTGT3' (P1F), 5'AAATGAGAACAGTGAGCAA3' (P2F), 5'CAAAGCTCCTCCACTCCGG3' (P3R), and 5'ATCCATAGTTGGGCCTTTACTACTTTA3' (P4R). As the reverse-transcribed control, HPRT was coamplified in a multiplex PCR (primers, 5'CCTGCTGGATTACATTAAAGCACTG3' and 5'CCTGAAGTATTCATTATAGTCAAGG3').

An 8.4-kb DNA fragment spanning the entire human myostatin gene from the 5' end of the messenger RNA (mRNA) to a site 1.4 kb downstream of the polyadenylation signal was cloned into pCMV5 and MDAF2 vectors, and the mutation was introduced by site-directed mutagenesis. COS-7, Chinese-hamster–ovary, and A204 rhabdomyosarcoma cells were transiently transfected with wild-type or mutantplasmids. Cells were cotransfected with plasmid containing a secreted myc-tagged protein as a transfection-efficiency control and with an expression construct for the furin protease paired dibasic amino acid–cleaving enzyme to improve processing of the precursor myostatin protein.¹⁴ Conditioned medium was concentrated, separated by reducing sodium dodecyl sulfate–polyacrylamide-gel electrophoresis, and transferred onto a membrane. Myostatin was detected with the use of polyclonal antibodies against a C-terminal domain.¹ The control myc-tagged protein was detected with the use of a monoclonal antibody against myc.

RNA from transiently transfected cells was treated with DNase I (Invitrogen) and amplified by means of reverse-transcriptase PCR with P2F and P4R primers. Wild-type and mutant bands were excised from the agarose gel, purified, and sequenced. The relative abundance of the wild-type and mutant bands was determined by measuring the relative fluorescence after amplification with a FAM-labeled P4R primer on an ABI 3100 gene scanner (Applied Biosystems).

For immunoprecipitation and Western blotting, JA-16–coupled beads (directed against a C-terminal peptide of myostatin) were prepared and myostatin was immunoprecipitated by incubating 60 µl of packed beads with 0.5 ml of serum. After washing, bound myostatin was eluted and further separated by sodium dodecyl sulfate–polyacrylamide-gel electrophoresis, blotted on a membrane, and probed with the polyclonal rabbit antibody L8825 against myostatin propeptide.